FAQ
Użytkownicy
Grupy
Galerie
Rejestracja
Zaloguj
Profil
Zaloguj się, by sprawdzić wiadomości
Szukaj
Forum Strona Główna
->
Zbocze
Napisz odpowiedź
Użytkownik
Temat
Treść wiadomości
Emotikony
Więcej Ikon
Kolor:
Domyślny
Ciemnoczerwony
Czerwony
Pomarańćzowy
Brązowy
Żółty
Zielony
Oliwkowy
Błękitny
Niebieski
Ciemnoniebieski
Purpurowy
Fioletowy
Biały
Czarny
Rozmiar:
Minimalny
Mały
Normalny
Duży
Ogromny
Zamknij Tagi
Opcje
HTML:
TAK
BBCode
:
TAK
Uśmieszki:
NIE
Wyłącz HTML w tym poście
Wyłącz BBCode w tym poście
Kod potwierdzający: *
Wszystkie czasy w strefie EET (Europa)
Skocz do:
Wybierz forum
Biblioteki Kreatorów
----------------
Księga Zasad
Księga Postaci
Księga Potworów i Bohaterów Niezależnych
FAQ
Miasto: Eriopolis
----------------
Dzielnica Portowa (północna)
Dzielnica Handlowa (wschodnia)
Dzielnica Wyższa (zachodnia)
Dzielnica Niższa (południowa)
Kanały pod Miastem
Okolice Miasta
Dzika Puszcza
----------------
Czarny Las
Wioska Bastai
Wzgórza i Góry
----------------
Las w cieniu Gór
Wzgórza
Zbocze
Chmurne Szczyty
Równina Mgieł
----------------
Wiśniowa Wioska
Stepy
Miasto: Arion
----------------
Arion (epidemia)
Wioska Pravium
Okolice Miasta Arion
Ocean Wiatrów
----------------
Szlaki Handlowe
Wyspa Rukia
Wyspa Piratów
Wyspa Kei-Sumi
W podróży
----------------
Tabor
Cyrk
Pustkowia
----------------
Bagna
Ruiny
Osiem szczytów
Wielkie lasy
Przegląd tematu
Autor
Wiadomość
defgf10aj
Wysłany: Sob 17:14, 23 Kwi 2011
Temat postu: christian louboutin prezzi Airway remodeling of as
1.2 .3 immunohistochemical staining of lung tissue sections affixed to glass slides, dried at room temperature after 30 min to 0.01 mol / L KPBS (pH 7.4) dipped by 800 mL / L methanol +30 mL / L H2O2 closed 15 min, KPBS dipping 3 times × 10 min, slices into the rabbit serum anti-MMP9 (1:100) incubated for 24 h. KPBS immersion at room temperature 3 × 10 min, into the combination of biotin goat anti-rabbit IgG serum (1:500), incubated at room temperature 2 h, KPBS dip 3 times × 10 min,
belstaff bolsas
, into the ABC complex (1:500) were incubated at room temperature 2 h, glucose oxidase DAB nickel sulfate amine color. after the termination of the color reaction, the conventional dehydration, the neutral gum were mounted. the same method using rabbit anti-TIMP1 staining. each slice under a microscope 5 randomly selected bronchial to brown-yellow granules in the cytoplasm of the deposition was positive. Image analysis of the staining of bronchial cells to represent the average density of MMP9, TIMP1 expression intensity.
【Abstract】 AIM: To investigate the roles of matrix metalloproteinase9 (MMP9) and tissue inhibitor of metalloproteinase1 (TIMP1) in airway remodeling of asthmaric guinea pigs. METHODS: Guinea pigs were sensitized with ovalbumin conjuncted with Al (OH) 3, and subsequently challenged repeatedly with ovalbumin aerosol. The guinea pigs were randomly divided into the control group, asthmatic 4, 6, 8week groups. The expressions of MMP9 and TIMP1 in bronchi and lung tissues were observed by immunohistochemistry combined with the microimage analysis. The levels of MMP9 mRNA and TIMP1 mRNA were determined by semiquantitative PCR. RESULTS: ① After repeated allergen challenge,
christian louboutin scarpe
, smooth muscle hyperplasia was obvious in guinea pig bronchi. Expression levels of MMP9 and TIMP1 in the epithelial cells of bronchi were significantly higher in asthmatic animals than those of control group. ② The expression of MMP9 in asthmatic guinea pigs lung tissues was 0.52 ± 0.05 in 4week group,
mbt laarzen
, 0.74 ± 0.05 in 6week group, 0.48 ± 0.04 in 8week group, 0.21 ± 0.04 in control group (P <0.05). The expression of TIMP1 in asthmatic guinea pigs lung tissues was 0.36 ± 0.04 in 4week group, 0.83 ± 0.05 in 6week group, 0.97 ± 0.05 in 8week group, 0.20 ± 0.02 in control group (P <0.05). ③ The results of immunocytochemistry were consistent with those of RTPCR . ④ The upregulation of MMP9 expression become slower than TIMP1 since the 4th week in asthmatic animals. So ratio of MMP9 / TIMP1 was decreased. CONCLUSION: The expression levels of MMP9 and TIMP1 were closely correlated with asthma airway remodeling, and the ratio of MMP9 / TIMP1 may reflecte the degree of asthma airway remodeling.
Statistical analysis: data for each group x ± s, said, using statistical software SPSS11.0 statistical analysis, using ONEWAY ANOVA analysis, pairwise comparison between groups using S
1 Materials and methods
1.1 egg protein material, combined with biotin goat anti-rabbit serum IgG, ABC complex were purchased from Sigma Company; rabbit anti-TIMP1 antibody, rabbit anti-MMP9 antibody was purchased from Wuhan Boster Company; Trizol reagent purchased from Invitrogen Corporation; Taq enzyme was purchased from Promega Corporation of Japan; MMP9 and TIMP1 upstream and downstream primers were synthesized by Beijing Bioko company; 402 ultrasonic atomizer inhaler together purchased from Shanghai Medical Equipment Factory; PTC100 type PCR instrument for the United States BioRab Company products; 32 male guinea pigs, weighing 200 ~ 250 g, the Fourth Military Medical University Experimental Animal Center.
Airway remodeling of asthmatic guinea pigs of matrix metalloproteinase
Of: Wang Guanghui, Jin Faguang, Chu Dongling, Duan
airway remodeling is airway inflammation repeated injury and repair of the results, patients with asthma is caused by irreversible airway obstruction pathophysiological basis, mainly as extracellular matrix (extracellular matrix, ECM) of the deposition, basement membrane thickening, airway smooth muscle hyperplasia and hypertrophy and other changes. which ECM deposition in the airway wall is caused by excessive fibrosis and airway wall of one of the main airflow obstruction [1]. the normal synthesis and degradation of ECM in a dynamic equilibrium among the matrix metalloproteinase 9 (matrix metalloproteinases, MMP9) and matrix metalloproteinase inhibitor 1 (tissue inhibitor of metalloproteinase, TIMP1) is to maintain the balance of ECM homeostasis determinant [2]. This experiment replicated guinea pig asthma model, using immunohistochemistry and RTPCR methods to measure lung asthmatic guinea pigs at different stages of MMP9 and TIMP1 in the content, and understand the MMPs / TIMP in asthma pathogenesis.
1.2.4MP9 and TIMP1 semi-quantitative PCR using Trizol reagent total lung tissue extract alternate RNA; synthetic cDNA; semi-quantitative PCR reaction: Taq enzyme 33.34 nkat, Buffer 2 μL, dNTP (10 μmol / L) 1 μL, MMP9 primers (5'AAGGATGGTCTACTGGCACA3 ') 10 μmol / L, 0.5 μL, MMP9 downstream primer (5'GAAGATGAATGGAAATACGC3', 10 μmol / L ,
MBT Schuhe günstig
,) 0.5 μL, template 1 μL, the total reaction volume of 20 μL. reaction conditions: 94 ℃ 1 min; 56 ℃ 45 s; 72 ℃ 1 min, 35 cycles. TIMP1 primers: upstream 5'ACAGCTTTCTGCAACTCG3 ', downstream 5'CTATAGGTCTTTACGAAGGCC3 ', PCR product length is 364 bp; condition: 98 ℃, denatured 10 min, then 94 ℃ for 1 min, 61 ℃ annealing 50 s, 72 ℃ extension of 1 min,
christian louboutin prezzi
, 35 cycles, and finally, 72 ℃ for 10 min . PCR products were agarose gel electrophoresis using gel image analysis system to read the gray value.
1.2.2 lung tissue derived animal models, fixed, sliced model in each group 48 h after the last challenge by intraperitoneal injection of pentobarbital sodium (40 mg / kg) anesthetized guinea pigs, guinea pigs thoracotomy the left lung specimens from frozen in liquid nitrogen, -70 ℃ save standby, the pulmonary artery 100 mL normal saline infusion, followed by freshly prepared 40 g / L paraformaldehyde PBs (0.1 mol / L, pH 7.4) 600 mL infusion 90 min, and remove the right lung fixed after 24 h, into the 200 g / PB L sucrose solution fluoride, 4 ℃ overnight to sink specimens, OCT embedded, constant cold box microtome serial sections (thickness 15 μm), -20 ℃ saved backup.
Abstract Objective: To investigate the guinea pig model of asthma of matrix metalloproteinases (MMPs) and their tissue inhibitors (TIMP) airway remodeling in asthma pathogenesis. Methods: Repeated ovalbumin inhalation aerosol guinea pig model of airway remodeling. were divided into control group, asthma excitation 4, 6 and 8 wk group. immunohistochemical method combined with microscopic image analysis detection MMP9, TIMP1 expression. semi-quantitative PCR detection of the level of MMP9 and TIMP1mRNA. Results: ① All the animals were there asthmatic wall thickening, smooth muscle so characteristic of airway remodeling changes. ② The mRNA expression of MMP9 guinea pigs: 4 wk group, asthma (0.52 ± 0.05), asthma, 6 wk group (0.74 ± 0.05); asthma 8 wk group (0.48 ± 0.04) ; the control group (0.21 ± 0.04); asthma group and control group differences between groups was statistically significant (P <0.05). TIMP1 the mRNA levels in asthmatic guinea pigs: 4 wk group, asthma (0.36 ± 0.04); asthma 6 wk group (0.83 ± 0.05); asthma 8 wk group (0.97 ± 0.05); the control group (0.20 ± 0.02); asthma group and control group differences between groups was statistically significant (P <0.05). ③ the results of immunohistochemistry and RTPCR were consistent. ④ group at all time asthma, MMP9 expression increased from the first 4 wk was clearly slowing down, and TIMP1 continued to increase, leading to MMP9 / TIMP1 ratio decreased. Conclusion: Asthma airway remodeling and the expression of MMP9 and TIMP1 are closely related, while the ratio between the two may reflect the severity of airway remodeling.
1.2 Methods
1.2.1 Experimental Animal grouping and model preparation Animals were randomly divided into control group and asthma 4, 6 and 8 wk group, n = 8. the asthma group were injected intraperitoneally on day 1 egg (with the same amount of aluminum hydroxide gel) 0.1 mg, 1 wk after the aerosol inhalation of 10 g / L concentration of protein solution asthmatic egg every other day 1, every 20 min, respectively, according to stimulate group 4,6 and 8 wk. guinea pigs after 1 shot began wheezing, breathing deepened to speed up performance of , intercostal space depression, severe asthma attack can occur asphyxia; breathing soon after the animals out of the bottle, breathing sustainable 30 min, or even longer; the control group as in section 1, normal saline 0.9 mg, 1 wk after the animals placed within a semi-enclosed glass saline aerosol inhalation of about 20 min, every other day 1, saline inhalation 8 wk.
Key words asthma; airway remodeling; gelatinase B; tissue inhibitor of metalloproteinase-1
【Keywords】 asthma; airway remodeling; gelatinase B; tissue inhibitor of metalloproteinase1
Key words asthma; airway remodeling; gelatinase B; metalloproteinase 1 tissue inhibitor More articles related to topics:
Easily into the spirit of the report will be presided over words _2683
GHD glätteisen günstig 10 cases of diabetes diagn
mbt schoenen online kopen Recruits in the farewell
fora.pl
- załóż własne forum dyskusyjne za darmo
Elveron phpBB theme/template by
Ulf Frisk
and
Michael Schaeffer
Copyright Š Ulf Frisk, Michael Schaeffer 2004
Powered by
phpBB
© 2001, 2002 phpBB Group
Regulamin